descriptive text

Evolutionary RNA Designer



descriptive text

Welcome to the Evolutionary RNA Designer (ERD) webserver !

This web server uses the, ERD program, to design sequences that fold into a given target RNA secondary structure, i.e. whose minimum free energy (MFE) structure is the target structure.

Determination that a sequence folds into a target structure is made using RNAfold from the Vienna RNA Package


Here is an example, applying ERD on the input MFE secondary structure of Oryza Sativa, given as "Oryza Sativa 4", in the list of challenge problems of EteRNA.

((((((((.(((((.((((((((((((((((((((((((.(((((((((((((.((((( (((((................))))))))))..(((((((((((((......))))))) ))))))))))))))))))).))))))))))))))))))))))))))))).))))))))

ERD returns a sequence within 625 ms, that folds into the target structure:

GCCCGGGGACCGGGGUGGCCGGCCCAUUAAUCGCCCGCCCAGGUUCCGGGGUCAGUACA AGGAAGGUCAAGAUAGUAAGGUUCUUUGUACACCAAAAUAUUUAUUGUUCGAAAUAAAU GUUUUGGAUUCCGGAACCUUGGCGGGCGGUUGGUGGGCCGGCCAUCCGGACCCCGGGU

VARNA is used for the graphical representation of the minimum free energy secondary structure of the sequence found by ERD.


RNA Designer input:

Structure to be designed, in dot-bracket format: Desired secondary structure, from 5' to 3'. Unpaired base positions are represented by ".", and paired base positions are represented by "(" and ")".

Sequence constraints:

Constraints on bases for individual sequence positions. If sequence constraints are used, a string of the same length as the desired secondary structure needs to be specified, using IUPAC nucleotide symbols (A,C,G,U,T for positions in which the respective base must appear; R, Y for positions in which A or G, C or U/T can appear; and N or - for positions in which any base can be used). If no sequence constraint string is specified, it is assumed that any base can occur in any position of the desired structure. Sequence constraints are always strictly enforced.

Temperature:

Desired folding temperature, i.e., the temperature at which the result sequence is predicted to have the specified secondary structure as its minimal free energy structure. The temperature is specified in degrees Celsius and is a real number between 0 and 100. The number must be expressed using decimal notation, e.g. 37 or 15.55.

Number of Execution:

The number of sequences that are to be designed. For values > 1, each sequence is designed in an independent run of the algorithm, using the same parameters, except for the random number seed. If a random number seed r is specified, the first sequence is designed using seed r, the next using r+1, etc.

Random number seed:

Optional parameter that represents the integer value used for initialising the random number generator. By specifying a seed value, the design process becomes completely deterministic and reproducible. If no value is specified, a value is derived from the system time on our server is used, and can be expected to be different for any two runs. In either case, the actual seed value used for each run is reported as part of the ouput, and can be used to reproduce that run.

Get results ...:

The user can choose whether to view the output on a dynamically generated web page, or to receive the output via email, or both, by clicking one or both of the "as web page" and "via e-mail" boxes. If a computation takes more than 3 minute, the web interface notifies the user that the result will be sent out only via e-mail. The user must enter an email address in the box provided, in order to receive the output via email.

RNA Designer output:

Sequence n and MFE structure:

Sequence found by RNA designer and corresponding minimal free energy structure as predicted by the Vienna folding algorithm at the specified temperature. Each result sequence and its predicted MFE structure can also be accessed in CT (Connectivity Table) format. If multiple sequences were designed, these are listed in order of increasing minimal free energy values of the predicted MFE structure.

Distance to desired structure:

Number of bases in the output sequence that are not paired (or unpaired) in the output secondary structure as specified in the input secondary structure. A value of O indicates that the predicted secondary structure of the result sequence precisely matches the desired secondary structure.

Minimum free energy:

Free energy of the predicted structure in kcal/mol, as computed by the Vienna RNA Package RNAfold algorithm.

Computation Time:

Total time in second required for obtaining the reported RNA Designer result on our server. Our current server machine is a PC with dual Intel Celeron 1.6GHz CPUs with 512 KB CPU cache each, and 1GB of RAM running Ubuntu Linux Server, Version 12.04.

Send these results by e-mail to ...:

Allows the user to send out the results via e-mail (primarily to themselves). Specify only one e-mail address in the field and press the "Send" button to send out the e-mail version of the results webpage.